Banco de dados de questões do vestibular
questões de vestibulares
|
 

Questões Outros

REF. Pergunta/Resposta
origem:Outros
tópico:
ecologia

sub-grupo:

pergunta:Tendo em vista os conceitos de CADEIA e TEIA alimentar, bem como de POPULAÇÃO e COMUNIDADE, podemos afirmar que:

a) A preá, a cobra e o gavião representam uma população e um exemplo de uma cadeia alimentar.
b) O conjunto de preás da região formam uma população e os consumidores, entredevorando-se, formam uma teia alimentar.
c) Preás e cobras do charco formam uma população e, para as cobras, as preás são produtoras de alimento.
d) Preás, cobras e gaviões formam uma comunidade; as cobras são consumidores primários e os gaviões consumidores secundários.
e) O conceito de produtor está associado ao fornecimento de alimento e, de consumidor, àqueles que o utilizam.

resposta:(a?) Veja nos comentários

origem:Outros
tópico:
ecologia

sub-grupo:

pergunta:Com referência à cadeia alimentar, marque a alternativa correta:

a) a energia contida no produtor diminui gradualmente, ao passar de consumidor a consumidor.
b) a energia do produtor aumenta gradualmente nos diferentes elementos da cadeia alimentar.
c) o potencial energético do produtor não sofre nenhuma alteração nos diferentes segmentos da cadeia alimentar.
d) na cadeia alimentar, como os animais são de tamanho diferentes , a quantidade energética do produtor sofre oscilações.
e) a complexidade da teia alimentar não interfere com a quantidade de energia transferida, que permanece inalterada.

resposta:A

origem:Outros
tópico:
ecologia

sub-grupo:

pergunta:Qual das alternativas a seguir responde corretamente a seguinte questão: “Que resultaria se desaparecesse do mar o fitoplâncton ?”

a) o equilíbrio ecológico desse ecossistema não sofreria alteração, visto que o fitoplâncton é constituído por seres apenas microscópios.
b) o zooplâncton ocuparia o seu lugar na cadeia alimentar, mantendo assim o equilíbrio ecológico do ecossistema.
c) a cadeia alimentar do ecossistema perderia o elo principal, pois do fitoplâncton depende praticamente toda a matéria orgânica necessária aos demais componentes bióticos.
d) o ecossistema não seria afetado visto que o plâncton é apenas um consumidor na cadeia alimentar.
e) o equilíbrio ecológico não seria alterado visto que nem todos os organismos marinhos se alimentam do fitoplâncton.

resposta:C

origem:Outros
tópico:
ecologia

sub-grupo:

pergunta:O aproveitamento das algas pelo homem torna-se cada vez mais acentuado. Em certos países asiáticos, as algas já fazem parte da dieta humana. Neste caso o homem comporta-se como:

a) consumidor primário.
b) consumidor secundário.
c) consumidor terciário.
d) produtor.
e) decompositor.

resposta:A

origem:Outros
tópico:
citologia

sub-grupo:

pergunta:Considere as seguintes estruturas celulares:

I- retículo endoplasmático.
II- complexo de Golgi.
III- grânulos de secreção.

A seqüência de estruturas em que seria encontrado um aminoácido radioativo, desde a entrada até sua saída da célula, é, respectivamente:
a) III, II, I
b) II, I , III
c) III, I, II
d) I, II, III
e) II, III, I

resposta:D

origem:Outros
tópico:
citologia

sub-grupo:

pergunta:Um material sintetizado por uma célula é "empacotado" para ser secretado para o meio externo no:

a) retículo endoplasmático
b) complexo de Golgi
c) lisossomo
d) nucléolo
e)vacúolo secretor

resposta:(B) Veja nos comentários

origem:Outros
tópico:
citologia

sub-grupo:

pergunta:Além de armazenar secreções, como o suco pancreático, essa organela pode sintetizar polissacarídios, como os que compoõem o muco intestinal, no homem. A organela a que se refere o texto acima é o:

a) ribossomo
b) ergastoplasma
c) retículo endoplasmático
d) condrioma
e) complexo de Golgi

resposta:(e ) Veja nos comentários

origem:Outros
tópico:
citologia

sub-grupo:

pergunta:O aspecto comum do Complexo de Golgi em células animais, deduzido através de observações ao microscópio eletrônico, é de:

a) vesículas formadas por membrana dupla, a interna sem granulações e com dobras voltadas para o interior.
b) vesículas formadas por membrana dupla em que a membranainterna, granulosa, emite prolongamentos em forma de dobras para o interior.
c) membranas formando tubos anastomosados com dilatações em forma de discos.
d) membranas lisas delimitando vesículas e sacos achatados que se dispõem paralelamente.
e) membranas granulosas delimitando vesículas e sacos achatados que se dispõem paralelamente.

resposta:D

origem:LONDRINA
tópico:
citologia

sub-grupo:

pergunta:Os grânulos que, ao microscópio eletrônico, são vistos sobre o retículo endoplasmático são os:

a) ribossomos.
b) mitocôndrios.
c) citocromos.
d) corpúsculos de Golgi.
e) vacúolos de pinocitose.

resposta:A

origem:Outros
tópico:
citologia

sub-grupo:

pergunta:O ergastoplasma é a região formada por cavidades tubulares, em cuja periferia situam-se numerosos ribossomos, constituindo local de:

a) circulação celular
b) digestão proteica
c) síntese proteica
d) respiração celular
e) sintese de lipídios

resposta:C

origem:Vunesp
tópico:
citologia

sub-grupo:

pergunta:Os procariontes diferenciam-se dos eucariontes porque os primeiros, entre outras características: a)não possuem material genético b)possuem material genético como os eucariontes, mas são anucleados c)possuem núcleo, mas o material genético encontra-se disperso no citoplasma d)possuem material genético disperso no núcleo, mas não em estruturas organizadas denominadas cromossomos e)possuem núcleo e material genético organizado nos cromossomos

resposta:c

origem:Outros
tópico:
Genética

sub-grupo:

pergunta:Em 1953, em um breve artigo na revista Nature, os pesquisadores J.
Watson e H. C.Crick propuseram um modelo para a estrutura da molécula de DNA.
Hoje, cinqüenta anos após, a molécula de DNA ainda é o foco de muitas discussões, pois as modernas técnicas de biologia molecular prometem causar uma revolução na vida dos homens.
Considerando esta molécula, responda aos itens abaixo.
a) Cite duas características da molécula de DNA, de acordo com o modelo proposto pelos pesquisadores acima.
b) Cite uma característica do processo de replicação da molécula de DNA em seres eucariontes.
c) Para a síntese protéica, cada trinca de bases da molécula de DNA corresponde a um aminoácido na proteína.
O DNA, entretanto, não participa diretamente da síntese de proteínas.
Cite a molécula que atua como intermediária neste processo.
d) A enzima de restrição EcoRI apresenta o seguinte sítio de clivagem:
G¯ AATTC
C­ TTAAG

Demonstre como ficará o fragmento de DNA representado abaixo, após a atuação dessa enzima.
5’AAGGTTCGAATTCAGTATATAACAGAATTCCCGGTA 3’
3’TTCCAAGCTTAAGTCATCAATTGTCTTAAGGGCCAT 5’

e) O seqüenciamento completo do genoma humano foi anunciado em 2003.
Explique o que se entende por seqüenciamento do genoma.


resposta:a) – Apresenta complementaridade das bases nitrogenadas; seus filamentos apresentam direções anti-paralelas.
b) É um processo semi-conservativo.
c) RNA d) 5’ AAGGTTCG 3’ 5’ AATTCAGTATATAACAG 3’ 5’ AATTCCCGGTA 3’ 3’ TTCCAAGC 5’ 3’ TTAAGTCATATATTGAC 5’ 3’ TTAAGGGCCAT 5’ e) O seqüenciamento do genoma significa a determinação da seqüência de bases nitrogenadas que compõem o genoma de determinada espécie.


 


morfologia sistema circulatorio arterias, veias e coração