Buscar por palavras, tópicos & origem // Química | Física | História | Português | Biologia | Geografia | Inglês | Matemática


Questões de biologia

Origem: Ufpel

(Ufpel-2006) Para a maioria das formigas, a reprodução sexuada ocorre através do processo de partenogênese. Porém, os machos da espécie Wasmannia auropunctata - pixixica - desenvolveram um novo método: eles podem fazer uma "autoclonagem". Em alguns dos ovos fecundados, o material genético da rainha é supostamente destruído pelo espermatozóide, gerando assim machos que contêm apenas os genes do pai, ou seja, um clone.
"Ciência Hoje", vol. 37, 2005 [adapt.].

Com base no texto e em seus conhecimentos, analise as seguintes afirmativas.

I. Os machos de pixixica, assim como a maioria dos machos de outras espécies de formigas, possuem apenas material genético proveniente do pai. Portanto, pode-se considerar que os machos de formigas são filhos apenas do pai.
II. A partenogênese, além das formigas, também ocorre em outros himenópteros, como as abelhas e vespas. Esse fenômeno é uma forma de reprodução e também um mecanismo de determinação sexual.
III. A partenogênese não é um processo comum; ela só ocorre quando há escassez de macho na colméia para realizar a fecundação. Em condições normais, o macho fecunda a fêmea, e essa utiliza os espermatozóides para fecundar os óvulos.
IV. No processo de partenogênese que ocorre nos himenópteros, os óvulos fecundados dão origem às fêmeas, e os óvulos não fecundados dão origem aos machos. Portanto os machos são apenas filhos apenas da mãe.
V. Nas abelhas, os machos são diplóides, e as fêmeas, haplóides, ou seja, os machos são organismos com n cromossomos, e as fêmeas, com 2n cromossomos.

Estão corretas apenas as afirmativas
a) I, II e III.
b) IV e V.
c) II e IV.
d) II e V
e) I, III e V

resposta:[C]



(Ufpel-2006)



O quadro apresentado ilustra uma chave dicotômica de Vertebrata. O sinal (+) indica a ocorrência da característica considerada e o sinal (-) indica sua ausência. Com base nela e em seus conhecimentos é correto afirmar que
a) os gnatostomatha definem a linhagem dos ciclóstomos atuais
b) os vertebrados sem mandíbula (Agnatha) definem a linhagem das lampreias e peixes-bruxa atuais
c) os condríctes são cordados invertebrados por não possuírem ainda esqueleto pós-cranial ossificado
d) definem a linhagem tetrapoda os grupos dos osteíctes, das Aves e dos mamíferos
e) a homeotermia é uma característica comum para os amniotas por exigir desses, a manutenção de altas taxas metabólicas



resposta:[B]



(Ufpel-2006) A união de vários aminoácidos forma os peptídeos. Estes, após passarem por diferentes processamentos no Retículo endoplasmático rugoso e complexo de Golgi, formam as proteínas.
As proteínas exercem inúmeras funções no nosso organismo, como por exemplo as funções enzimáticas. Para descobrir se determinado organismo produz determinada proteína, faz-se a construção de uma fita de RNA mensageiro a partir dela. Isso é possível graças à relação existente entre os códons do RNA mensageiro (cada três nucleotídeos) e os aminoácidos presentes nas proteínas. Cada três nucleotídeos correspondem a um aminoácido, portanto, a partir de uma seqüência de aminoácidos (peptídeo), é possível obter uma seqüência de nucleotídeos (RNA mensageiros). O inverso também pode ocorrer.
A correspondência entre os códons do RNA mensageiro e os aminoácidos por ele determinados constitui o código genético, que está representado na tabela a seguir:




Phe (fenilalanina), Leu (leucina), Ile (isoleucina), Met (metionina), Val (valina), Ser (serina), Pro (prolina), Thr (treonina), Ala (alanina), Tyr (tirosina), His (histidina), Gln (glutanina), Asn (asparagina), Lys (lisina), Asp (ácido aspártico), Glu (ácido glutâmico), Cys (cisteína), Trp (triptofano), Arg (arginina), Gly (glicina), pare (códon de parada).

Com base no texto e em seus conhecimentos, é correta a seguinte afirmação:
a) O peptídeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro: GGCGGUGCGCACCGCCUUAUUCAA.
b) A partir da seqüência do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC, é formado o seguinte peptídeo: Phe-His-Ser-Ala-Gly-Arg-His.
c) A partir da seqüência do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG, é formado o seguinte peptídeo: Val-Val-Val-Val-Arg-Arg-Arg.
d) A partir da seqüência do RNA mensageiro UUAGGGGAGACUCGGCAGGAG, é formado o seguinte peptídeo Leu-Gly-Glu-Thr-Arg-Gln-Glu.
e) O peptídeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA.



resposta:[D]



(Ufpel-2006) E a rã foi para o brejo. Frase utilizada por pesquisadores da Unesp de Rio Claro - SP para relatar a presença de um fungo letal para algumas espécies de rãs brasileiras. Esse fungo arrasou populações inteiras de anfíbios na América Central e na Ásia, fato que, segundo os pesquisadores, promoveu a proliferação de insetos nessas regiões. Esse fungo ( Batrachoclytrium dendrobatidis ) foi identificado na rã-corredeira, da Serra da Mantiqueira, juntamente com outras quatro espécies de rãs no Brasil.
"Revista Terra": n.162, outubro de 2005.

De acordo com o texto e seus conhecimentos é correto afirmar que:
a) os organismos rã, fungo e insetos pertencem respectivamente aos taxa Anura, Fungi e Arthropoda, sendo que o fungo é uma espécie letal e em desequilíbrio dentro de ecossistemas brasileiros
b) o fato desse fungo ser uma espécie comensal e ter causado indiretamente a proliferação de insetos mostra que o mesmo está em desequilíbrio com o ecossistema local da Serra da Mantiqueira
c) Batrachoclytrium dendrobatidis é uma espécie de fungo a qual foi identificada no organismo de uma rã, vertebrado amniótico pertencente ao grupo dos anuros
d) esse fungo arrasou populações inteiras de anfíbios na América Central e na Ásia, fato que, segundo os pesquisadores, promoveu a proliferação de insetos nessas regiões, o que concretiza um desequilíbrio ecológico baixo, pois envolve somente bos Reinos Fungi e Vertebrata
e) Batrachoclytrium dendrobatidis é uma espécie que foi identificada no organismo de uma rã e foi classificada ecologicamente, como um tipo de relação intra-específica desarmônica do tipo predatismo

resposta:[A]



(Ufpel-2006) A erva-de-passarinho é um problema bastante visível nas zonas urbanas, como observado em Pelotas. Ela compete com a árvore por luz e se apropria da seiva desta, ao introduzir raízes especializadas até o xilema do caule das árvores. Muitas espécies de ervas-de-passarinho são disseminadas com auxílio de pássaros, que comem as sementes e, por meio das fezes, "plantam" o novo hóspede em outra árvore.
Revista "Ciência Hoje", v.37, dez. 2005 [adapt.]
LOPES, S. Bio. São Paulo: Ed. Saraiva, v.2, 2003.

De acordo com o texto e seus conhecimentos é correto afirmar que a erva-de-passarinho é uma planta
a) hemi-parasita, pois possui folhas clorofiladas, portanto realiza fotossíntese, e retira apenas a seiva bruta da planta hospedeira através dos haustórios.
b) parasita, pois retira seiva elaborada da planta hospedeira através das raízes especializadas denominadas pneumatófaros.
c) hemi-parasita, que apresenta uma relação intra-específica com seu hospedeiro denominada parasitismo.
d) parasita, pois nutre-se de compostos orgânicos oriundos da seiva bruta das árvores, os quais são retirados por raízes especializadas denominadas haustórios.
e) Epífita, que nutre-se de compostos inorgânicos oriundos da seiva elaborada das árvores, os quais são retirados pelos pneumatófaros.

resposta:[A]



(Ufpel-2006) "Nunca se imaginou que houvesse uma fauna tão rica que pode viver incrustada em grãos de areia e fragmentos de conchas pequenas". Essas são observações feitas por biólogos do Centro de Biologia Marinha da USP, após coletarem amostras de sedimento retirado do fundo oceânico do litoral norte de São Paulo. De profundidades que variavam de nove a quarenta e cinco metros emergiram treze espécies de invertebrados (cnidários, poliquetos e diminutos caramujos marinhos) que habitavam a superfície e os poros de fragmentos de conchas, o cascalho e os grãos da areia mais grossa.
Pesquisa FAPESP: n.112, junho de 2005.

De acordo com o texto e seus conhecimentos é correto afirmar que
a) a biodiversidade dos sedimentos do assoalho marinho (nécton) é representada por treze espécies distribuídas respectivamente dentro dos filos Cnidaria, Annelida e Gastropoda
b) muitos invertebrados bentônicos encontram nos grãos de areia e nos fragmentos de conchas entre nove e quarenta e cinco metros (zona afótica) um local adequado para se fixarem
c) os cnidários juntamente com os vermes marinhos (poliquetas) pertencem ao grupo de organismos milimétricos denominados de cordados invertebrados
d) os biólogos que estudam os "bentos", são aqueles que dedicam-se a toda e qualquer forma de biodiversidade que vive sobre ou sob o leito marinho
e) o leito marinho em profundidades a partir dos quarenta e cinco metros é formado por fragmentos de conchas, cascalho e grãos da areia mais grossa, que serve de abrigo para os cordados invertebrados citados no texto

resposta:[D]



(Ufpel-2006) Observe a teia alimentar a seguir representada. Ela demonstra uma situação atual envolvendo o dingo¢, uma forma de canídeo selvagem, o lagarto gigante, cangurus-vermelhos£ da espécie Macropus rufus e a espécie humana, em ecossistemas naturais¤ do continente australiano. Componentes desses ecossistemas constituem a alimentação natural dos cangurus-vermelhos, sendo definidos por pradarias, savanas e bosques abertos da Austrália central.




De acordo com a teia alimentar e seus conhecimentos de zoologia e relações ecológicas entre produtores, consumidores primários e secundários é correto afirmar que:
a) o declínio na população de dingos e lagartos somado a grande oferta de alimentos provenientes das fazendas australianas, promove um crescimento populacional fora do controle de cangurus-vermelhos, fato que causa perdas significativas no sistema de produção agrícola dos australianos
b) o manejo em campo buscando o aumento nas populações de dingos e lagartos atenuaria o crescimento populacional de cangurus-vermelhos, já que esses mamíferos placentários são herbívoros por excelência
c) uma hipotética proibição das atuais e novas fazendas na Austrália central resolveria em definitivo o aumento desordenado da população de cangurus-vermelhos bem como o fornecimento de energia alimentar tanto para os cangurus quanto para a espécie humana
d) segundo o esquema, é possível considerar que os cangurus são formas predadoras de mamíferos aplacentários juntamente com os dingos (Canidae) e os lagartos gigantes (Reptilia)
e) o canguru-vermelho constitui-se em um mamífero aplacentário mais derivado evolutivamente que os demais mamíferos placentários e a ação antrópica sobre essa espécie está no manejo agrícola inapropriado dos ecossistemas locais da Austrália.

¢Juntamente com o lagarto gigante, esse canídeo encontra-se em declínio por ação antrópica.
£Beneficiados pelas fazendas estimaram-se em 2005 que existiam cerca de 60 milhões de cangurus-vermelhos, uma relação de três animais para cada cidadão australiano.
¤Alterados pela construção de grandes fazendas agrícolas.



resposta:[A]



(Ufpel-2006) O jacaré do pantanal Caiman crocodilus yacare , (assim como Caiman latirostris ou jacaré do papo amarelo) é um réptil da família dos aligatorídeos. Pode atingir por volta de três metros de comprimento e viver até trinta anos. Com hábitos anfíbios vive muito bem fora e dentro da água. É essencialmente carnívoro, menos agressivo que seus primos crocodilídeos e alimenta-se de peixes, anfíbios e aves, além de invertebrados aquáticos como caranguejos. Procurado por caçadores em função de sua carne saborosa e pele nobre, acabou por tornar-se, muitas vezes, um símbolo para a preservação do Pantanal. Formas jovens desse jacaré controlam populações de insetos nocivos ao homem e caramujos, como os que transmitem a esquistossomose.
Modificado de "Terra" n.165, janeiro de 2003.

De acordo com o texto e seus conhecimentos é correto afirmar que Caiman crocodilus yacare
a) é uma subespécie, assim representada nomenclaturalmente, no texto que é importante ecologicamente no controle biológico de organismos potencialmente nocivos a saúde humana por predar, entre outras formas, caramujos transmissores da esquistossomose
b) Com seus hábitos anfíbios pode viver muito bem fora e dentro da água sendo assim, considerado reprodutivamente um vertebrado anamniótico
c) embora tenha o nome popular diferente por questões regionais, o jacaré do pantanal pode ser considerado pertencente a mesma subespécie do jacaré do papo amarelo
d) o jacaré do pantanal Caiman crocodilus yacare assim como Caiman latirostris ou jacaré do papo amarelo são ambos aligatorídeos e pertencem à mesma família e gênero dentro de Crocodilidae
e) as funções de controle biológico executadas por Caiman crocodilus yacare ocorrem diretamente em organismos do Filo Mollusca, como os cefalópodes comprovadamente transmissores da esquistossomose para a espécie humana

resposta:[A]



(Ufpel-2006) Uma determinada espécie vegetal apresenta variação para cor da flor - roxo e branco -, cor do hipocótilo - roxo e verde - e pilosidade no cálice da flor - com (piloso) e sem (glabro). A cor roxa da flor e do hipocótilo e a presença de pilosidade são dominantes. Em todos os cruzamentos realizados entre plantas fenotipicamente diferentes e após avaliações em várias gerações segregantes, foi observado que todas as plantas que apresentavam flores roxas, o hipocótilo era roxo e todas as plantas que apresentavam flores de cor branca, o hipocótilo era verde (situação 1). Entretanto, ao cruzarem um duplo heterozigoto para os caracteres cor da flor e pilosidade no cálice da flor com um duplo-recessivo, foi observada na progênie a seguinte proporção (situação 2):




Com base no texto e em seus conhecimentos é correto afirmar que
a) a primeira situação pode representar um caso de pleiotropia e a segunda mostra um caso de ligação gênica.
b) a primeira situação pode representar um caso de pleiotropia e a segunda evidencia uma segregação independente dos genes.
c) a primeira situação evidencia ligação gênica e a segunda mostra a segregação independente dos genes.
d) em ambas as situações ficou evidenciado o efeito pleiotrópico entre os genes.
e) em ambas as situações ficou evidenciada a ligação gênica, sendo que na segunda, a ligação é mais forte do que na primeira, o que mostra uma distância menor entre os genes.



resposta:[A]



(Ufpel-2006) O sistema endócrino é responsável pela produção de hormônios, mensageiros químicos que fazem a comunicação entre as células do organismo.
A figura a seguir indica algumas das principais glândulas de um homem:




Com base na figura e em seus conhecimentos é INCORRETO fazer a seguinte afirmação.
a) O órgão C corresponde ao pâncreas, uma glândula mista. A parte endócrina produz dois hormônios: a insulina e o glucagon. A insulina aumenta o nível de glicose no sangue, e o glucagon o reduz.
b) Os testículos também são chamados de glândulas sexuais, pois eles produzem os gametas, além dos hormônios. O principal hormônio é a testosterona.
c) O órgão B corresponde às glândulas suprarenais, que recebem esse nome devido à sua localização acima do rim. Um dos hormônios que elas produzem é a adrenalina, que provoca um rápido aumento na taxa metabólica basal.
d) Na tireóidea, ocorre a produção de tri-iodotironina (T3) e tiroxina (T4). A falta desse hormônio causa o hipotireoidismo, e o excesso, o hipertireoidismo. Na infância, se o nível desses hormônios for baixo, pode ocorrer o cretinismo.
e) O órgão A corresponde ao timo. Ele além de ser uma glândula endócrina, é um órgão linfóide, pois nele ocorre a formação dos linfócitos, células envolvidas na defesa do corpo.



resposta:[A]



(Ufpel-2006) Nos fungos, a reprodução pode ser tanto assexual quanto sexual. A reprodução assexual pode ocorrer através da simples divisão celular por mitose ou produzindo estruturas especializadas para dispersão do fungo, os esporos. A reprodução sexual pode ocorrer entre indivíduos geneticamente diferentes, entre indivíduos com a mesma constituição genética ou entre duas células do mesmo indivíduo. Nos fungos que passam quase todo o ciclo na fase haplóide, a fusão de células reprodutivas (uma de cada parceiro) forma uma célula diplóide que, em geral, logo depois sofre meiose, gerando os esporos sexuais.
Revista "Ciência Hoje", v.37, agosto/2005. [adapt.]




Com base nos textos e em seus conhecimentos, analise as afirmativas.

I. As hifas dos micélios se fundem e originam um micélio com células binucleadas (V) e então as hifas binucleadas formam o corpo de frutificação - basidiocarpo (I).
II. Os indivíduos oriundos de reprodução por esporulação apresentam maior vantagem adaptativa às condições adversas do meio do que os oriundos de basidiósporos formados a partir da fusão de núcleos de micélios geneticamente diferentes.
III. O fungo representado na figura, assim como os demais do reino Fungi, é heterótrofo. Ele é um Basidiomiceto que pode apresentar organização unicelular ou filamentoso.
IV. No basidiocarpo, algumas hifas transformam-se em basídios (II), local onde os dois núcleos se fundem, formando um núcleo zigótico diplóide. Após a meiose, cada um destes núcleos origina 4 basidiósporos (III).

Estão corretas apenas as afirmativas
a) I e III.
b) I e IV.
c) II e IV.
d) II e III.
e) III e IV.



resposta:[B]



(Ufpel-2007) Andar por um manguezal não é para qualquer um. Você pode atolar até os joelhos e perder os sapatos no primeiro passo. A cada passada é preciso erguer o pé para fora da lama, sem tropeçar nas raízes - são pneumatóforos, que emergem da lama na vertical, e rizóforos, que saem do tronco e deixam o mangue-vermelho ou mangue-sapateiro ( Rhizophora mangle ) com mais jeito de aranha do que de árvore. Ao fixar o olhar nesse emaranhado, tudo parece mexer-se. Inúmeros caranguejos de várias espécies vivem enterrados na lama, entre as raízes, em cima delas ou mesmo nos troncos e copas das árvores.




Com base nos textos e em seus conhecimentos, é INCORRETO afirmar que
a) os pneumatóforos, estruturas que emergem da lama, são raízes que têm a função de levar oxigênio do ar para as raízes subterrâneas.
b) as estruturas que saem do tronco das árvores do mangue, referidas no texto, e lhe dão aspecto de aranha, são "raízes-escora" - adaptações à sustentação no solo mole do manguezal.
c) os manguezais apresentam o solo saturado de água doce, local em que habitam espécies de caranguejos - animais que diferem dos outros artrópodes pela ausência de antenas.
d) os caranguejos, animais típicos existentes nos manguezais, são artrópodes crustáceos que apresentam o sistema excretor composto por glândulas verdes ou antenais.
e) os caranguejos apresentam o corpo dividido em cefalotórax e abdome, respiração branquial, sistema circulatório aberto e sistema digestivo completo.



resposta:[C]



(Ufpel-2007) Os artrópodes constituem o mais numeroso grupo animal existente na Terra: de cada quatro animais, três são artrópodes. O nome desse filo deriva do fato de todos os animais pertencentes a esse Táxon possuírem pernas articuladas, assim como as demais extremidades, representadas pelas antenas e peças bucais.

Com base no texto e em seus conhecimentos, é correto afirmar em relação aos artrópodes que
a) os insetos apresentam corpo dividido em cabeça, tórax e abdome. Possuem um par de antenas na cabeça, três pares de pernas no tórax e podem ou não ter asas.
b) os echinodermos são animais acelomados, triblásticos e cujas características se aproximam dos cordados por serem protostômios.
c) os aracnídeos apresentam geralmente seu corpo dividido em cefalotórax e abdome, um par de antenas, quatro pares de pernas no abdome e quelíceras.
d) os crustáceos possuem um exoesqueleto quitinoso, dois pares de antenas na região cefálica, dois olhos compostos e geralmente pedunculados e, ao redor da boca, dois pares de mandíbulas.
e) os diplópodes, como o piolho-de-cobra, possuem corpo dividido em cabeça e tronco, dois pares de patas por segmento do tronco, dois pares de antenas e um par de mandíbulas.

resposta:[A]



(Ufpel-2007) Miller, em 1953, testou a hipótese da Evolução gradual dos sistemas químicos para provar a origem da vida no planeta Terra. Para isso, ele construiu um aparelho que simulava as condições da Terra primitiva, introduziu nele gases que provavelmente constituíam a atmosfera e colocou água, a qual, ao ser fervida, formava vapor. A mistura gasosa foi submetida a descargas elétricas, simulando as condições do clima da época. Após a condensação do material, verificou-se a presença de aminoácidos.

Baseado no texto e em seus conhecimentos, é INCORRETO afirmar que o experimento de Miller
a) obteve moléculas orgânicas que fazem parte das proteínas, as quais exercem papéis essenciais nas células, como por exemplo, as funções enzimáticas.
b) não provou a formação de uma molécula com função de gene. Essa molécula provavelmente tenha sido semelhante ao RNA, pois ele, além de transmitir as características, tem capacidade de se autoduplicar.
c) provou apenas a formação de moléculas e não a origem do primeiro ser vivo; provavelmente esse era semelhante a um procarionte atual, apresentando apenas uma membrana externa, citoplasma e material genético disperso.
d) provou que, sob certas condições, é possível haver formação de compostos orgânicos, sem a participação de seres vivos.
e) não provou a formação de moléculas com função energética, portanto os primeiros seres vivos provavelmente eram heterotróficos, produzindo seu próprio alimento.

resposta:[E]



(Ufpel-2007) Os moluscos possuem sistema digestório completo e com hábitos alimentares variados, podendo ser herbívoros ou carnívoros. Alguns possuem na faringe uma placa de dentes chamada rádula utilizada para ralar o alimento a ser ingerido. Entretanto, outros alimentam-se de organismos microscópicos, tais como protozoários, algas e bactérias e por isso recebem a denominação de filtradores.

Com base no texto e em seus conhecimentos, é correto afirmar que a rádula ocorre nos moluscos pertencentes às Classes
a) Pelecypoda (mexilhões e ostras) e Polyplacophora (chiton).
b) Gastropoda (mariscos e ostras) e Pelecypoda (caracóis terrestres).
c) Polyplacophora (polvos e lulas) e Cephalopoda (caracóis aquáticos).
d) Cephalopoda (lulas e polvos) e Gastropoda (lesmas e caracóis).
e) Gastropoda (lulas e polvos) e Monoplacophora (Neopalina).

resposta:[D]



(Ufpel-2007) Os nutrientes minerais presentes no solo são absorvidos pelas raízes das plantas em solução aquosa, por meio dos pêlos absorventes. Em plantas herbáceas, as regiões mais velhas das raízes também fazem absorção de água, o mesmo acontecendo em zonas parcialmente suberificadas das raízes de arbustos e árvores. Feita a absorção pela raiz, na zona pilífera ou não, as soluções com os solutos minerais seguem até o lenho, onde iniciam um deslocamento vertical para chegar à copa.




Com base nos textos e em seus conhecimentos, é correto afirmar que
a) as soluções aquosas percorrem o caule até a copa das árvores devido à ação do processo de transpiração nas folhas e das forças de coesão e tensão que ocorrem no interior dos vasos condutores da seiva elaborada (floema) (D).
b) as soluções aquosas podem passar de célula para célula (B) pelas paredes, até atingir o xilema (D). Esse percurso é feito livremente, sem a necessidade de osmose e difusão, processos que envolvem gasto de energia.
c) o deslocamento das soluções aquosas através dos espaços intercelulares (A) é mais rápido e direto. As soluções atingem as células de passagem da endoderme (C) e então passam para os vasos lenhosos (xilema) (D).
d) o deslocamento das soluções aquosas através dos plasmodesmos das células (A) é mais rápido e direto. As soluções atingem as células de passagem do córtex (C) e posteriormente passam para os vasos lenhosos (xilema) (D).
e) as soluções aquosas percorrem o caule até a copa das árvores devido à ação do processo de capilaridade, em que a água se desloca para cima ao passar pelos vasos bem finos formados por vasos liberianos (floema) (D).



resposta:[C]



(Ufpel-2007) Os quatro fenótipos do sistema sangüíneo ABO são determinados por três alelos múltiplos denominados IÞ, Iß e i. Os alelos IÞ e Iß são dominantes em relação ao alelo i, sendo a relação de dominância escrita da seguinte forma: IÞ = Iß > i.
AMABIS, J.M.; MARTHO, G.R. "Conceitos de Biologia". V.3. São Paulo: Ed. Moderna, 2001.

Com base no texto e em seus conhecimentos sobre a herança do sistema sangüíneo ABO, analise as seguintes afirmativas.

I. Os alelos IÞ e Iß apresentam co-dominância, pois ambos se expressam na condição heterozigótica e produzem, respectivamente, os aglutinogênios A e B.
II. O alelo i determina a ausência de aglutinina no sangue, portanto o genótipo ii corresponde ao sangue tipo "O", sem aglutinina anti-A e anti-B.
III. Um homem com o sangue tipo "B" poderá ter filhos com o sangue tipo "A", desde que seja heterozigoto, e somente com uma mulher com sangue do tipo "A" (homozigota ou heterozigota).
IV. Um casal pode ter filhos com os quatro tipos sangüíneos, desde que um dos cônjuges tenha o sangue do tipo "A" e o outro do tipo "B" e que ambos sejam heterozigotos.

Estão corretas apenas as afirmativas
a) II e III.
b) I e IV.
c) I e III.
d) II e IV.
e) III e IV.

resposta:[B]



(Ufpel-2007) Um dos principais problemas em cirurgias de emergência - a falta de sangue compatível com o da vítima para transfusões - pode estar prestes a ser resolvido. Uma equipe internacional de pesquisadores descobriu uma maneira de converter sangue dos tipos A, B e AB, que hoje podem ser doados apenas com restrição, no tipo O. Os cientistas descreveram o uso de novas enzimas que "limpam" esses tipos sanguíneos de seus antígenos, tornando-os viáveis para qualquer tipo de transfusão. Esta possibilidade liberaria os hospitais da dependência do tipo O.
"O Estado de S. Paulo"
(http://www.universia.com.br/noticia/materia_clipping.jsp?not=36754, acessado em 20/04/2007). [Adapt.]

Com base no texto e em seus conhecimentos, desconsiderando o fator RH, é correto afirmar que, através da nova tecnologia,
a) uma pessoa com sangue tipo "O" poderia receber sangue de qualquer outro grupo sangüíneo, pois os sangues tipo "A", "B" e "AB" não apresentariam aglutinogênios "A" e "B" nas hemácias; não ocorreriam, portanto, reações de aglutinação.
b) uma pessoa com sangue tipo "O" poderia receber sangue de qualquer outro grupo sangüíneo, pois os sangues tipo "A", "B" e "AB" não apresentariam aglutininas anti-A e anti-B no plasma; não ocorreriam, portanto, reações de aglutinação.
c) uma pessoa com sangue tipo "A" poderia receber sangue, além do tipo "O" e "A", dos tipos "B" e "AB", pois os anticorpos anti-A e anti-B, presentes nas hemácias do sangue desses grupos sangüíneos, seriam neutralizados.
d) uma pessoa com sangue tipo "B" poderia receber sangue, além do tipo "O" e "B", dos tipos "A" e "AB", pois os aglutinogênios "A" e "B", presentes no plasma do sangue desses grupos sangüíneos, seriam neutralizados.
e) todos os grupos sangüíneos seriam doadores universais, pois seriam eliminados os aglutinogênios anti-A e anti-B das hemácias e as aglutininas A e B do plasma; não ocorreriam mais reações de aglutinação.

resposta:[A]



(Ufpel-2007) Situada nas montanhas e planícies costeiras, de clima quente com média anual de 21,1 °C, é muito úmida com precipitação média anual de 2.246 mm, graças aos ventos carregados de vapor que sopram do mar. A vegetação é bastante densa e higrófila, podendo atingir 30 metros de altura com muitas espécies de epífitas, como bromélias e orquídeas. Entre a vegetação arbórea característica, encontramos muitos ipês, canelas, cedros, jatobás, o raro pau-brasil e muitas palmeiras das quais se obtém, por exemplo, o palmito.

Com base no texto e em seus conhecimentos, é correto afirmar que estas características são marcantes de
a) floresta pluvial, como a Floresta Amazônica.
b) floresta temperada decídua, como a Mata Atlântica.
c) floresta pluvial costeira, como a Mata Atlântica.
d) floresta tropical, como as florestas de araucária.
e) floresta fluvial tropical, como o pantanal Matogrossense.

resposta:[C]







« anterior | próxima »